Sample multiplexing, also known as multiplex sequencing, allows libraries to be pooled and sequenced simultaneously during a single run on Illumina® instruments. When you are working with libraries obtained with different library preparation kits, or different vendors, it is not uncommon that libraries will have indexes of different lengths, raising the question of whether it is possible to mix them or not. Pooling libraries with different index lengths in the same NGS run is possible, as long as each sample has a unique i5 and i7 index. If, for example, you are trying to combine a library with 8 nt and another one with 10 nt index, the first 8 nt will have to be unique amongst each of them.
To ensure compatibility of the libraries, you will have to modify the index sequences listed in the sample sheet. Following the previous example, if you are pooling libraries with indexes 10 nt and 8 nt, you should set the index length of the run to 10 nt, and “add” 2 bases to the end of each 8 nt index, so the final length of the indexes of all samples is 10. Depending on the difference between the short and the long library, the number of bases to be added to the short libraries will be different.
So, let's say we want to combine in the same pool our NEXTFLEX™ ultra high-throughput unique dual index barcodes (10 nt)
NEXTFLEX Unique Dual Index Barcodes (8NT index, 1-96)
with our NEXTFLEX 384 unique dual index barcode set (8 nt)
NEXTFLEX UDI Barcodes (10NT, 1-1,536)
. For simplicity we will be focusing on the i7 of the library but same procedure should be carried out for i5.
NEXTFLEX 1536 UDI barcodes (P7 sequence)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXXXXXATCTCGTATGCCGTCTTCTGCTTG NEXTFLEX® 384 UDI barcodes (P7 sequence)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACXXXXXXXXATCTCGTATGCCGTCTTCTGCTTG
In this case you will have add in the sample sheet 2 nt to the NEXTFLEX® DNA barcodes, to have at the end a length of 8+2 = 10
| 17 Index | Index | Modified index for sample sheet |
|---|---|---|
| Barcode Adapter 1 | AATCGTTA | AATCGTTAAT |
| Barcode Adapter 2 | GTCTACAT | GTCTACATAT |
| Barcode Adapter 3 | CGCTGCTC | CGCTGCTCAT |
| Barcode Adapter 4 | GATCAACA | GATCAACAAT |
Since the added bases are the same in all the short libraries, we recommend > 50% of the pool consists of libraries with longest index. This will ensure there is sufficient base diversity in the last four bases of the index read. If this rule is not followed, the run won't fail, but the quality of the last bases will drop.
See our complete line of sequence tested NEXTFLEX® NGS barcodes for multiplexing. We have barcodes to meet your needs.
For research use only. Not for use in diagnostic procedures.